Transcript: Mouse XM_006517307.3

PREDICTED: Mus musculus chemokine (C-X-C motif) ligand 14 (Cxcl14), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cxcl14 (57266)
Length:
1069
CDS:
390..986

Additional Resources:

NCBI RefSeq record:
XM_006517307.3
NBCI Gene record:
Cxcl14 (57266)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517307.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065371 ACGGGTCCAAGTGTAAGTGTT pLKO.1 451 CDS 100% 4.950 6.930 N Cxcl14 n/a
2 TRCN0000065370 GAGCACCAAACGCTTCATCAA pLKO.1 623 CDS 100% 4.950 3.960 N Cxcl14 n/a
3 TRCN0000065369 CTGCGAGGAGAAGATGGTTAT pLKO.1 539 CDS 100% 10.800 7.560 N Cxcl14 n/a
4 TRCN0000065368 CAAGTGGTACAATGCCTGGAA pLKO.1 641 CDS 100% 2.640 1.848 N Cxcl14 n/a
5 TRCN0000057927 GATCCGCTACAGCGACGTGAA pLKO.1 488 CDS 100% 1.350 0.945 N CXCL14 n/a
6 TRCN0000057924 CGACGTGAAGAAGCTGGAAAT pLKO.1 500 CDS 100% 10.800 6.480 N CXCL14 n/a
7 TRCN0000065372 GCTGGAAATGAAGCCAAAGTA pLKO.1 512 CDS 100% 5.625 3.375 N Cxcl14 n/a
8 TRCN0000057925 CGAGGAGAAGATGGTTATCAT pLKO.1 542 CDS 100% 5.625 4.500 N CXCL14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517307.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02194 pDONR223 100% 43.7% 43.3% None (many diffs) n/a
2 ccsbBroad304_02194 pLX_304 0% 43.7% 43.3% V5 (many diffs) n/a
3 TRCN0000478372 TCAGTGTATGGAGTGATTCGCTGT pLX_317 90% 43.7% 43.3% V5 (many diffs) n/a
Download CSV