Transcript: Mouse XM_006517330.3

PREDICTED: Mus musculus single-stranded DNA binding protein 2 (Ssbp2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ssbp2 (66970)
Length:
2922
CDS:
1766..2887

Additional Resources:

NCBI RefSeq record:
XM_006517330.3
NBCI Gene record:
Ssbp2 (66970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517330.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108599 CTCAGAAATCGGCTCAGACAT pLKO.1 1929 CDS 100% 4.950 3.960 N Ssbp2 n/a
2 TRCN0000108597 CCCAACAAATGCGAATTCAAT pLKO.1 2518 CDS 100% 0.000 0.000 N Ssbp2 n/a
3 TRCN0000312905 TCAGCGTCTCCTGGGAATTAC pLKO_005 2549 CDS 100% 13.200 9.240 N Ssbp2 n/a
4 TRCN0000108596 CCATCACATGAACGGCTCTTT pLKO.1 2755 CDS 100% 4.950 3.465 N Ssbp2 n/a
5 TRCN0000311812 CCATCACATGAACGGCTCTTT pLKO_005 2755 CDS 100% 4.950 3.465 N Ssbp2 n/a
6 TRCN0000108598 CCAACACGACAACAAGGACAT pLKO.1 2309 CDS 100% 4.050 2.835 N Ssbp2 n/a
7 TRCN0000311811 CCAACACGACAACAAGGACAT pLKO_005 2309 CDS 100% 4.050 2.835 N Ssbp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517330.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02815 pDONR223 100% 77.3% 75% None (many diffs) n/a
2 ccsbBroad304_02815 pLX_304 0% 77.3% 75% V5 (many diffs) n/a
3 TRCN0000474390 CTAATACAGTTAGACAACTACTTC pLX_317 50.5% 77.3% 75% V5 (many diffs) n/a
Download CSV