Construct: ORF TRCN0000474390
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008331.1_s317c1
- Derived from:
- ccsbBroadEn_02815
- DNA Barcode:
- CTAATACAGTTAGACAACTACTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SSBP2 (23635)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474390
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23635 | SSBP2 | single stranded DNA binding... | NM_012446.4 | 100% | 100% | |
| 2 | human | 23635 | SSBP2 | single stranded DNA binding... | NM_001256732.2 | 97.8% | 97.8% | 567_590del |
| 3 | human | 23635 | SSBP2 | single stranded DNA binding... | NM_001256733.2 | 94.4% | 94.4% | 368_369ins60 |
| 4 | human | 23635 | SSBP2 | single stranded DNA binding... | XM_017009305.1 | 94.2% | 93.6% | (many diffs) |
| 5 | human | 23635 | SSBP2 | single stranded DNA binding... | XM_017009304.1 | 92.2% | 91.6% | (many diffs) |
| 6 | human | 23635 | SSBP2 | single stranded DNA binding... | NM_001256735.2 | 91.6% | 91.6% | 282_283ins90 |
| 7 | human | 23635 | SSBP2 | single stranded DNA binding... | XM_017009306.2 | 90.8% | 90.8% | 957_958ins99 |
| 8 | human | 23635 | SSBP2 | single stranded DNA binding... | NM_001256734.2 | 89.7% | 89.7% | 282_283ins90;477_500del |
| 9 | human | 23635 | SSBP2 | single stranded DNA binding... | NM_001345886.1 | 88.8% | 88.8% | 567_590del;981_982ins99 |
| 10 | human | 23635 | SSBP2 | single stranded DNA binding... | XM_017009307.2 | 86.1% | 85.4% | (many diffs) |
| 11 | human | 23635 | SSBP2 | single stranded DNA binding... | NM_001256736.2 | 82.5% | 82.5% | 282_283ins90;867_868ins99 |
| 12 | human | 23635 | SSBP2 | single stranded DNA binding... | XM_017009308.1 | 67.4% | 67.4% | 0_1ins336;231_254del |
| 13 | human | 23635 | SSBP2 | single stranded DNA binding... | XM_017009309.1 | 67.4% | 67.4% | 0_1ins336;231_254del |
| 14 | human | 23635 | SSBP2 | single stranded DNA binding... | XM_017009310.1 | 67.4% | 67.4% | 0_1ins336;231_254del |
| 15 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | NM_024272.4 | 95.6% | 99.7% | (many diffs) |
| 16 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | XM_006517331.3 | 93.5% | 97.5% | (many diffs) |
| 17 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | XM_006517329.3 | 88.2% | 88.6% | (many diffs) |
| 18 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | XM_011244554.1 | 88.1% | 91.8% | (many diffs) |
| 19 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | NM_024186.5 | 87.8% | 91.6% | (many diffs) |
| 20 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | XM_006517328.3 | 86.4% | 86.8% | (many diffs) |
| 21 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | XM_006517333.2 | 85.9% | 89.7% | (many diffs) |
| 22 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | XM_006517334.3 | 81.9% | 85% | (many diffs) |
| 23 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | XM_006517332.3 | 80.8% | 81.1% | (many diffs) |
| 24 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | XM_011244553.2 | 79.2% | 79.5% | (many diffs) |
| 25 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | XM_006517330.3 | 77.3% | 75% | (many diffs) |
| 26 | mouse | 66970 | Ssbp2 | single-stranded DNA binding... | XM_017315572.1 | 62.3% | 65% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1149
- ORF length:
- 1083
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgta cggcaaaggc aagagtaaca gcagcgccgt cccgtccgac agccaggccc 121 gggagaagtt agcactctac gtatatgaat atctgctcca tgtaggagct cagaaatcag 181 ctcaaacatt tttatcagag ataagatggg aaaaaaacat cacattgggg gaaccaccag 241 gattcttaca ttcttggtgg tgtgtatttt gggatctcta ctgtgcagct ccagagagac 301 gtgaaacatg tgaacactca agtgaagcaa aagccttcca tgattacagt gctgcagcag 361 ctcccagtcc agtgctagga aacattcccc caggagatgg catgccagta ggtcctgtac 421 caccagggtt ctttcagcct tttatgtcac ctcggtaccc tggaggtcca aggcccccat 481 tgaggatacc taatcaggca cttggaggtg tcccaggaag tcagccatta ctccccagtg 541 gaatggatcc aactcgacaa caaggacatc caaatatggg tgggccaatg cagagaatga 601 cTCCTCCAAG AGGAATGGTG CCCTTAGGAC CACAGAACTA TGGAGGTGCA ATGAGACCCC 661 CACTGAATGC TTTAGGTGGC CCTGGAATGC CTGGAATGAA CATGGGTCCA GGTGGTGGTA 721 GACCTTGGCC AAACCCAACA AATGCCAATT CAATACCATA CTCCTCAGCA TCTCCTGGGA 781 ATTATGTAGG TCCTCCAGGA GGTGGAGGGC CACCAGGAAC ACCCATCATG CCTAGTCCAG 841 CAGATTCAAC CAACTCTGGT GATAACATGT ATACTTTAAT GAATGCAGTA CCTCCTGGAC 901 CTAACAGACC TAATTTTCCA ATGGGTCCTG GGTCAGATGG TCCCATGGGT GGATTAGGAG 961 GAATGGAGTC ACATCACATG AATGGCTCTT TAGGCTCAGG AGATATGGAC AGTATTTCCA 1021 AGAATTCTCC CAATAATATG AGCCTGAGTA ATCAACCGGG CACTCCAAGG GATGATGGCG 1081 AAATGGGGGG AAATTTCTTA AATCCTTTTC AGAGTGAGAG TTACTCCCCT AGCATGACAA 1141 TGAGCGTGTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1201 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1261 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACTAATA CAGTTAGACA ACTACTTCAC 1321 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt