Transcript: Mouse XM_006517333.2

PREDICTED: Mus musculus single-stranded DNA binding protein 2 (Ssbp2), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ssbp2 (66970)
Length:
1778
CDS:
209..1228

Additional Resources:

NCBI RefSeq record:
XM_006517333.2
NBCI Gene record:
Ssbp2 (66970)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312945 GGAAGAGAATGCATCGTATAT pLKO_005 1474 3UTR 100% 13.200 18.480 N Ssbp2 n/a
2 TRCN0000016214 CCAAGAATTCTCCCAATAATA pLKO.1 1095 CDS 100% 0.000 0.000 N SSBP2 n/a
3 TRCN0000312859 AGTTAGCACTCTACGTGTATG pLKO_005 270 CDS 100% 10.800 14.040 N Ssbp2 n/a
4 TRCN0000108599 CTCAGAAATCGGCTCAGACAT pLKO.1 312 CDS 100% 4.950 3.960 N Ssbp2 n/a
5 TRCN0000108597 CCCAACAAATGCGAATTCAAT pLKO.1 811 CDS 100% 0.000 0.000 N Ssbp2 n/a
6 TRCN0000312905 TCAGCGTCTCCTGGGAATTAC pLKO_005 842 CDS 100% 13.200 9.240 N Ssbp2 n/a
7 TRCN0000108596 CCATCACATGAACGGCTCTTT pLKO.1 1048 CDS 100% 4.950 3.465 N Ssbp2 n/a
8 TRCN0000311812 CCATCACATGAACGGCTCTTT pLKO_005 1048 CDS 100% 4.950 3.465 N Ssbp2 n/a
9 TRCN0000108595 GCGATGATTATCTGTGTGTAT pLKO.1 1448 3UTR 100% 4.950 3.465 N Ssbp2 n/a
10 TRCN0000108598 CCAACACGACAACAAGGACAT pLKO.1 602 CDS 100% 4.050 2.835 N Ssbp2 n/a
11 TRCN0000311811 CCAACACGACAACAAGGACAT pLKO_005 602 CDS 100% 4.050 2.835 N Ssbp2 n/a
12 TRCN0000348499 ATGACCATGAGCGTGTGATAG pLKO_005 1211 CDS 100% 10.800 5.400 Y Ssbp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02815 pDONR223 100% 85.9% 89.7% None (many diffs) n/a
2 ccsbBroad304_02815 pLX_304 0% 85.9% 89.7% V5 (many diffs) n/a
3 TRCN0000474390 CTAATACAGTTAGACAACTACTTC pLX_317 50.5% 85.9% 89.7% V5 (many diffs) n/a
Download CSV