Transcript: Mouse XM_006517373.4

PREDICTED: Mus musculus solute carrier family 35, member D2 (Slc35d2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Slc35d2 (70484)
Length:
2140
CDS:
75..866

Additional Resources:

NCBI RefSeq record:
XM_006517373.4
NBCI Gene record:
Slc35d2 (70484)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517373.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068838 GCGATCAAGAATGTATCGGTT pLKO.1 672 CDS 100% 2.640 3.696 N Slc35d2 n/a
2 TRCN0000068840 GCTATCATACTTGGGACACAA pLKO.1 255 CDS 100% 4.950 3.960 N Slc35d2 n/a
3 TRCN0000068841 GCTCATCCCAACTGTCATTAT pLKO.1 485 CDS 100% 13.200 9.240 N Slc35d2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517373.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02606 pDONR223 100% 67.6% 69.8% None (many diffs) n/a
2 ccsbBroad304_02606 pLX_304 0% 67.6% 69.8% V5 (many diffs) n/a
3 TRCN0000476320 GTTAGAAGACCTGCGACGCTAGGT pLX_317 38.2% 67.6% 69.8% V5 (many diffs) n/a
Download CSV