Transcript: Mouse XM_006517539.3

PREDICTED: Mus musculus kinesin family member 2A (Kif2a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kif2a (16563)
Length:
2781
CDS:
43..2022

Additional Resources:

NCBI RefSeq record:
XM_006517539.3
NBCI Gene record:
Kif2a (16563)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089655 CCCAAACAGAAAGTAGACTTA pLKO.1 676 CDS 100% 4.950 6.930 N Kif2a n/a
2 TRCN0000089653 CGACTGTAAAGGCCACTTGAA pLKO.1 2080 3UTR 100% 4.950 6.930 N Kif2a n/a
3 TRCN0000089656 CCAGGATGTTGATGCTACAAA pLKO.1 456 CDS 100% 5.625 3.938 N Kif2a n/a
4 TRCN0000089657 CCGAGCCTTAGGTAGAAACAA pLKO.1 1377 CDS 100% 5.625 3.938 N Kif2a n/a
5 TRCN0000089654 CCCAGGATGTTGATGCTACAA pLKO.1 455 CDS 100% 4.950 3.465 N Kif2a n/a
6 TRCN0000108388 CCTATTGATGAACATAGGATA pLKO.1 553 CDS 100% 0.495 0.347 N KIF2A n/a
7 TRCN0000300439 CCTATTGATGAACATAGGATA pLKO_005 553 CDS 100% 0.495 0.347 N KIF2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10935 pDONR223 100% 89.1% 94.9% None (many diffs) n/a
2 ccsbBroad304_10935 pLX_304 0% 89.1% 94.9% V5 (many diffs) n/a
3 TRCN0000474910 TTTTTTGAAATTTAATGCATTTTA pLX_317 19.3% 89.1% 94.9% V5 (many diffs) n/a
Download CSV