Transcript: Mouse XM_006517612.3

PREDICTED: Mus musculus DEP domain containing 1B (Depdc1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Depdc1b (218581)
Length:
2511
CDS:
139..1647

Additional Resources:

NCBI RefSeq record:
XM_006517612.3
NBCI Gene record:
Depdc1b (218581)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176211 GCCATTGAAGCATTTCAGCTT pLKO.1 979 CDS 100% 2.640 2.112 N Depdc1b n/a
2 TRCN0000193186 CCATTGAAGCATTTCAGCTTT pLKO.1 980 CDS 100% 4.950 3.465 N Depdc1b n/a
3 TRCN0000193930 CTGTGCTCTAAGGATGAAGTA pLKO.1 1150 CDS 100% 4.950 3.465 N Depdc1b n/a
4 TRCN0000173585 GAAGTCATAGCCGACGACAAA pLKO.1 1429 CDS 100% 4.950 3.465 N Depdc1b n/a
5 TRCN0000061869 GCAGCCTATGTACTTGGGATT pLKO.1 837 CDS 100% 4.050 2.835 N DEPDC1B n/a
6 TRCN0000194491 GCAGCCTATGTACTTGGGATT pLKO.1 837 CDS 100% 4.050 2.835 N Depdc1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08587 pDONR223 100% 81.9% 88.8% None (many diffs) n/a
2 ccsbBroad304_08587 pLX_304 0% 81.9% 88.8% V5 (many diffs) n/a
3 ccsbBroadEn_14207 pDONR223 100% 32.2% 35.2% None (many diffs) n/a
4 ccsbBroad304_14207 pLX_304 0% 32.2% 35.2% V5 (many diffs) n/a
Download CSV