Transcript: Mouse XM_006518020.2

PREDICTED: Mus musculus family with sequence similarity 107, member A (Fam107a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam107a (268709)
Length:
3346
CDS:
492..926

Additional Resources:

NCBI RefSeq record:
XM_006518020.2
NBCI Gene record:
Fam107a (268709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264835 ACGCACCCAAGAGTGGTATAT pLKO_005 1710 3UTR 100% 13.200 10.560 N Fam107a n/a
2 TRCN0000190070 GAGTTCATCAAAGTCCGGGAA pLKO.1 858 CDS 100% 2.160 1.728 N Fam107a n/a
3 TRCN0000264834 GGAACTCAGAGCTCATCAAAC pLKO_005 562 CDS 100% 10.800 7.560 N Fam107a n/a
4 TRCN0000264836 CGCAGGAATCAGCTGATCAAA pLKO_005 714 CDS 100% 5.625 3.938 N Fam107a n/a
5 TRCN0000264832 GCACCGTGAGCTGCTTATGAA pLKO_005 632 CDS 100% 5.625 3.938 N Fam107a n/a
6 TRCN0000264833 AGTTCATCAAAGTCCGGGAAA pLKO_005 859 CDS 100% 4.050 2.835 N Fam107a n/a
7 TRCN0000200486 CCCTTTAACATAGTTTCTCAT pLKO.1 2559 3UTR 100% 4.950 2.970 N Fam107a n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1061 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02640 pDONR223 100% 86.3% 90.9% None (many diffs) n/a
2 ccsbBroad304_02640 pLX_304 0% 86.3% 90.9% V5 (many diffs) n/a
3 TRCN0000466642 TAAAACCTATGCACGCATGGCATA pLX_317 73.8% 86.3% 90.9% V5 (many diffs) n/a
Download CSV