Transcript: Mouse XM_006518023.2

PREDICTED: Mus musculus family with sequence similarity 107, member A (Fam107a), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam107a (268709)
Length:
3012
CDS:
158..592

Additional Resources:

NCBI RefSeq record:
XM_006518023.2
NBCI Gene record:
Fam107a (268709)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264835 ACGCACCCAAGAGTGGTATAT pLKO_005 1376 3UTR 100% 13.200 10.560 N Fam107a n/a
2 TRCN0000190070 GAGTTCATCAAAGTCCGGGAA pLKO.1 524 CDS 100% 2.160 1.728 N Fam107a n/a
3 TRCN0000264834 GGAACTCAGAGCTCATCAAAC pLKO_005 228 CDS 100% 10.800 7.560 N Fam107a n/a
4 TRCN0000264836 CGCAGGAATCAGCTGATCAAA pLKO_005 380 CDS 100% 5.625 3.938 N Fam107a n/a
5 TRCN0000264832 GCACCGTGAGCTGCTTATGAA pLKO_005 298 CDS 100% 5.625 3.938 N Fam107a n/a
6 TRCN0000264833 AGTTCATCAAAGTCCGGGAAA pLKO_005 525 CDS 100% 4.050 2.835 N Fam107a n/a
7 TRCN0000200486 CCCTTTAACATAGTTTCTCAT pLKO.1 2225 3UTR 100% 4.950 2.970 N Fam107a n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 727 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02640 pDONR223 100% 86.3% 90.9% None (many diffs) n/a
2 ccsbBroad304_02640 pLX_304 0% 86.3% 90.9% V5 (many diffs) n/a
3 TRCN0000466642 TAAAACCTATGCACGCATGGCATA pLX_317 73.8% 86.3% 90.9% V5 (many diffs) n/a
Download CSV