Transcript: Mouse XM_006518050.1

PREDICTED: Mus musculus filamin, beta (Flnb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Flnb (286940)
Length:
9023
CDS:
191..7927

Additional Resources:

NCBI RefSeq record:
XM_006518050.1
NBCI Gene record:
Flnb (286940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518050.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091375 CCGTTACCTATATCCCTGATA pLKO.1 4920 CDS 100% 4.950 6.930 N Flnb n/a
2 TRCN0000332426 CCGTTACCTATATCCCTGATA pLKO_005 4920 CDS 100% 4.950 6.930 N Flnb n/a
3 TRCN0000091374 GCCGACATTGAAATGCCGTTT pLKO.1 3563 CDS 100% 4.050 5.670 N Flnb n/a
4 TRCN0000332358 GCCGACATTGAAATGCCGTTT pLKO_005 3563 CDS 100% 4.050 5.670 N Flnb n/a
5 TRCN0000091889 CCAGCCAAATTCACGGTAGAT pLKO.1 1010 CDS 100% 4.950 3.960 N LOC432918 n/a
6 TRCN0000091891 GCTGGAAACTACAGGGAACAT pLKO.1 1279 CDS 100% 4.950 3.960 N LOC432918 n/a
7 TRCN0000091373 GCCCAAATCAAGACTCTTAAT pLKO.1 8145 3UTR 100% 13.200 9.240 N Flnb n/a
8 TRCN0000332353 GCCCAAATCAAGACTCTTAAT pLKO_005 8145 3UTR 100% 13.200 9.240 N Flnb n/a
9 TRCN0000091890 CCAGGTGTATAGATGTGTCTA pLKO.1 1423 CDS 100% 4.950 3.465 N LOC432918 n/a
10 TRCN0000091377 CCCACATACGATGCAAGCAAA pLKO.1 4727 CDS 100% 4.950 3.465 N Flnb n/a
11 TRCN0000091376 GCTCCTGGAAATTACCTGATT pLKO.1 7454 CDS 100% 4.950 3.465 N Flnb n/a
12 TRCN0000354142 GCTCCTGGAAATTACCTGATT pLKO_005 7454 CDS 100% 4.950 3.465 N Flnb n/a
13 TRCN0000091888 GCACATTTCTAAGAGCCCATT pLKO.1 1198 CDS 100% 4.050 2.835 N LOC432918 n/a
14 TRCN0000091892 GCATAAAGTCATCGTCCTCTT pLKO.1 1168 CDS 100% 4.050 2.835 N LOC432918 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8782 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518050.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.