Transcript: Mouse XM_006518321.2

PREDICTED: Mus musculus glypican 5 (Gpc5), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpc5 (103978)
Length:
3509
CDS:
194..1975

Additional Resources:

NCBI RefSeq record:
XM_006518321.2
NBCI Gene record:
Gpc5 (103978)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427883 ACGGATGTTGGACTCTATTTA pLKO_005 848 CDS 100% 15.000 21.000 N Gpc5 n/a
2 TRCN0000109543 CGCCAGGATGTTAGTCCATTT pLKO.1 1004 CDS 100% 10.800 15.120 N Gpc5 n/a
3 TRCN0000109541 CGGATGTTAATCCCGAGGAAT pLKO.1 876 CDS 100% 4.950 6.930 N Gpc5 n/a
4 TRCN0000109542 GCGAAGAAGTTCGGAAACTTT pLKO.1 501 CDS 100% 0.563 0.788 N Gpc5 n/a
5 TRCN0000109544 GCTCAACATTAAAGTTGCTAA pLKO.1 690 CDS 100% 4.950 3.960 N Gpc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00562 pDONR223 100% 69.3% 70.8% None (many diffs) n/a
2 ccsbBroad304_00562 pLX_304 0% 69.3% 70.8% V5 (many diffs) n/a
3 TRCN0000465883 CTCAAGAGTACCAACAATTCGGTT pLX_317 17.9% 69.3% 70.8% V5 (many diffs) n/a
Download CSV