Transcript: Mouse XM_006518367.2

PREDICTED: Mus musculus abhydrolase domain containing 4 (Abhd4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abhd4 (105501)
Length:
2393
CDS:
132..1088

Additional Resources:

NCBI RefSeq record:
XM_006518367.2
NBCI Gene record:
Abhd4 (105501)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518367.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032558 GCGAATCCACTTAATTCGAAA pLKO.1 875 CDS 100% 0.495 0.693 N Abhd4 n/a
2 TRCN0000326288 GCGAATCCACTTAATTCGAAA pLKO_005 875 CDS 100% 0.495 0.693 N Abhd4 n/a
3 TRCN0000032555 CCGTTATGTATCCCTCCCAAA pLKO.1 194 CDS 100% 4.050 3.240 N Abhd4 n/a
4 TRCN0000306193 GGATGACACCATCTCGGAATA pLKO_005 761 CDS 100% 10.800 7.560 N Abhd4 n/a
5 TRCN0000306192 GTATATCCCAAGCTCTCATTG pLKO_005 1588 3UTR 100% 10.800 7.560 N Abhd4 n/a
6 TRCN0000032556 CCAGACTTCAAGCGCAAGTTT pLKO.1 726 CDS 100% 5.625 3.938 N Abhd4 n/a
7 TRCN0000326286 CCAGACTTCAAGCGCAAGTTT pLKO_005 726 CDS 100% 5.625 3.938 N Abhd4 n/a
8 TRCN0000032557 CGCACACTTCATACCTTTGAT pLKO.1 342 CDS 100% 5.625 3.938 N Abhd4 n/a
9 TRCN0000326287 CGCACACTTCATACCTTTGAT pLKO_005 342 CDS 100% 5.625 3.938 N Abhd4 n/a
10 TRCN0000032554 GCAAGAGATAAGGGCAGGATA pLKO.1 1618 3UTR 100% 4.950 3.465 N Abhd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518367.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03902 pDONR223 100% 84.4% 89.7% None (many diffs) n/a
2 ccsbBroad304_03902 pLX_304 0% 84.4% 89.7% V5 (many diffs) n/a
3 TRCN0000475126 CTATCAAGTACTGAGGACATGGTA pLX_317 2.4% 84.4% 89.7% V5 (many diffs) n/a
4 ccsbBroadEn_03903 pDONR223 100% 84.4% 89.7% None (many diffs) n/a
5 ccsbBroad304_03903 pLX_304 0% 84.4% 89.7% V5 (many diffs) n/a
6 TRCN0000476601 GGCTCACAACAACTTTAGGAACAT pLX_317 37.5% 84.4% 89.7% V5 (many diffs) n/a
Download CSV