Transcript: Mouse XM_006518505.1

PREDICTED: Mus musculus cornichon family AMPA receptor auxiliary protein 1 (Cnih1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnih1 (12793)
Length:
1597
CDS:
20..745

Additional Resources:

NCBI RefSeq record:
XM_006518505.1
NBCI Gene record:
Cnih1 (12793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109833 GACCGACTACAAGAACCCTAT pLKO.1 367 CDS 100% 4.050 3.240 N Cnih1 n/a
2 TRCN0000309615 GACCGACTACAAGAACCCTAT pLKO_005 367 CDS 100% 4.050 3.240 N Cnih1 n/a
3 TRCN0000336366 TCGCCATCTGGCACATCATAG pLKO_005 330 CDS 100% 10.800 7.560 N Cnih1 n/a
4 TRCN0000109830 CCACCAATGAAGGGATTCTAT pLKO.1 788 3UTR 100% 5.625 3.938 N Cnih1 n/a
5 TRCN0000309547 CCACCAATGAAGGGATTCTAT pLKO_005 788 3UTR 100% 5.625 3.938 N Cnih1 n/a
6 TRCN0000109834 GCATGATCTATGTTCTGGTGA pLKO.1 717 CDS 100% 2.640 1.848 N Cnih1 n/a
7 TRCN0000331954 GCATGATCTATGTTCTGGTGA pLKO_005 717 CDS 100% 2.640 1.848 N Cnih1 n/a
8 TRCN0000109832 CATACCATATTTGGAGGTATA pLKO.1 558 CDS 100% 1.080 0.756 N Cnih1 n/a
9 TRCN0000309616 CATACCATATTTGGAGGTATA pLKO_005 558 CDS 100% 1.080 0.756 N Cnih1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518505.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02341 pDONR223 100% 54.9% 59.7% None (many diffs) n/a
2 ccsbBroad304_02341 pLX_304 0% 54.9% 59.7% V5 (many diffs) n/a
3 TRCN0000477860 CAGTTCTTACCAGCCGAGTAATGA pLX_317 56.4% 54.9% 59.7% V5 (many diffs) n/a
Download CSV