Transcript: Mouse XM_006518510.3

PREDICTED: Mus musculus dopachrome tautomerase (Dct), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dct (13190)
Length:
1220
CDS:
17..979

Additional Resources:

NCBI RefSeq record:
XM_006518510.3
NBCI Gene record:
Dct (13190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111880 TGACCTGGGTAGTAACTAATT pLKO.1 997 3UTR 100% 13.200 18.480 N Dct n/a
2 TRCN0000111884 GCGTTGCCCTACTGGAACTTT pLKO.1 146 CDS 100% 5.625 7.875 N Dct n/a
3 TRCN0000111883 CCTATGAAGGTTTGCTGAGAA pLKO.1 330 CDS 100% 4.950 3.465 N Dct n/a
4 TRCN0000111882 CCAGAACTCTACCTTCAGCTT pLKO.1 445 CDS 100% 2.640 1.848 N Dct n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00427 pDONR223 100% 51.6% 52.7% None (many diffs) n/a
2 ccsbBroad304_00427 pLX_304 0% 51.6% 52.7% V5 (many diffs) n/a
3 TRCN0000467690 TACACGGGCCCTAACCAGGCATTT pLX_317 22.7% 51.6% 52.7% V5 (many diffs) n/a
Download CSV