Transcript: Mouse XM_006518549.4

PREDICTED: Mus musculus fibroblast growth factor 14 (Fgf14), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Fgf14 (14169)
Length:
2077
CDS:
970..1458

Additional Resources:

NCBI RefSeq record:
XM_006518549.4
NBCI Gene record:
Fgf14 (14169)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518549.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066989 CCAAGGATGACAGCACCAATT pLKO.1 1265 CDS 100% 10.800 7.560 N Fgf14 n/a
2 TRCN0000066991 ACCAGGTTATATTGCAGGCAA pLKO.1 1201 CDS 100% 2.640 1.848 N Fgf14 n/a
3 TRCN0000066992 GCAAGGCTACTACTTGCAGAT pLKO.1 1218 CDS 100% 0.405 0.284 N Fgf14 n/a
4 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1790 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518549.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00560 pDONR223 100% 59.1% 56% None (many diffs) n/a
2 ccsbBroad304_00560 pLX_304 0% 59.1% 56% V5 (many diffs) n/a
3 TRCN0000478594 TCCGATACATCGCTTTAATTTGAC pLX_317 47.7% 59.1% 56% V5 (many diffs) n/a
Download CSV