Transcript: Mouse XM_006518552.3

PREDICTED: Mus musculus fibroblast growth factor 17 (Fgf17), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fgf17 (14171)
Length:
2009
CDS:
865..1482

Additional Resources:

NCBI RefSeq record:
XM_006518552.3
NBCI Gene record:
Fgf17 (14171)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518552.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067141 CATCGTGGAGACAGATACATT pLKO.1 1089 CDS 100% 5.625 3.938 N Fgf17 n/a
2 TRCN0000067138 CCTGTGCTTGCAGCTATTGAT pLKO.1 897 CDS 100% 5.625 3.938 N Fgf17 n/a
3 TRCN0000067139 GAGCGAGAAGTACATCTGTAT pLKO.1 1140 CDS 100% 4.950 3.465 N Fgf17 n/a
4 TRCN0000067140 CCACTTCATCAAGCGCCTCTA pLKO.1 1347 CDS 100% 4.050 2.835 N Fgf17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518552.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02024 pDONR223 100% 86.4% 93.5% None (many diffs) n/a
2 ccsbBroad304_02024 pLX_304 0% 86.4% 93.5% V5 (many diffs) n/a
3 TRCN0000467429 AATGTCTTGTTCAGAGGGACGTGC pLX_317 54.2% 86.4% 93.5% V5 (many diffs) n/a
Download CSV