Transcript: Mouse XM_006518684.2

PREDICTED: Mus musculus prepronociceptin (Pnoc), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pnoc (18155)
Length:
1164
CDS:
211..849

Additional Resources:

NCBI RefSeq record:
XM_006518684.2
NBCI Gene record:
Pnoc (18155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518684.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106567 GAAGCGGTTCAGTGAGTTTAT pLKO.1 681 CDS 100% 13.200 18.480 N Pnoc n/a
2 TRCN0000106568 TCCAGACAGCTTCAACTTAAA pLKO.1 315 CDS 100% 13.200 9.240 N Pnoc n/a
3 TRCN0000155758 CAGAAGCGGTTCAGTGAGTTT pLKO.1 679 CDS 100% 4.950 3.465 N PNOC n/a
4 TRCN0000106569 CTCTGGACTGTATGCACCAAA pLKO.1 379 CDS 100% 4.950 3.465 N Pnoc n/a
5 TRCN0000106566 CCAGTGTGAAGAGAAGGTCTT pLKO.1 348 CDS 100% 4.050 2.835 N Pnoc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518684.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01226 pDONR223 100% 71.3% 68.3% None (many diffs) n/a
2 ccsbBroad304_01226 pLX_304 0% 71.3% 68.3% V5 (many diffs) n/a
3 TRCN0000468662 GGACCCTTACTTCTTAAAGTAAAT pLX_317 62.4% 71.3% 68.3% V5 (many diffs) n/a
Download CSV