Transcript: Mouse XM_006518695.2

PREDICTED: Mus musculus protein kinase C, delta (Prkcd), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prkcd (18753)
Length:
3060
CDS:
444..2546

Additional Resources:

NCBI RefSeq record:
XM_006518695.2
NBCI Gene record:
Prkcd (18753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022844 CCTCACCGATTCAAGGTTTAT pLKO.1 1131 CDS 100% 13.200 18.480 N Prkcd n/a
2 TRCN0000280560 CCTCACCGATTCAAGGTTTAT pLKO_005 1131 CDS 100% 13.200 18.480 N Prkcd n/a
3 TRCN0000022848 GAATCCCAAGTTTGAGCAATT pLKO.1 2513 CDS 100% 10.800 7.560 N Prkcd n/a
4 TRCN0000280559 GAATCCCAAGTTTGAGCAATT pLKO_005 2513 CDS 100% 10.800 7.560 N Prkcd n/a
5 TRCN0000022847 GTCGGAATATACCAGGGATTT pLKO.1 1365 CDS 100% 10.800 7.560 N Prkcd n/a
6 TRCN0000022845 CCTTCAGACTACAGCAACTTT pLKO.1 2394 CDS 100% 5.625 3.938 N Prkcd n/a
7 TRCN0000280561 CCTTCAGACTACAGCAACTTT pLKO_005 2394 CDS 100% 5.625 3.938 N Prkcd n/a
8 TRCN0000022846 GCTGGGAGTAACAGGAAACAT pLKO.1 2285 CDS 100% 5.625 3.938 N Prkcd n/a
9 TRCN0000280497 GCTGGGAGTAACAGGAAACAT pLKO_005 2285 CDS 100% 5.625 3.938 N Prkcd n/a
10 TRCN0000010203 GCAGGGATTAAAGTGTGAAGA pLKO.1 1211 CDS 100% 4.950 3.465 N PRKCD n/a
11 TRCN0000272685 GCAGGGATTAAAGTGTGAAGA pLKO_005 1211 CDS 100% 4.950 3.465 N PRKCD n/a
12 TRCN0000010194 CAAGGCTACAAATGCAGGCAA pLKO.1 996 CDS 100% 2.640 1.848 N PRKCD n/a
13 TRCN0000379731 CATTACTTGAATGTAGTTATC pLKO_005 2775 3UTR 100% 10.800 7.560 N PRKCD n/a
14 TRCN0000196625 GCTGTATATATTGCTCAGTAG pLKO.1 2833 3UTR 100% 4.050 2.835 N PRKCD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489248 TTGAACAGTACCCTATCAGCCCTG pLX_317 19.4% 83.7% 87% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491986 TAATCCTCAGGCACGGTGTTGGTT pLX_317 18% 83.7% 86.9% V5 (many diffs) n/a
Download CSV