Transcript: Mouse XM_006518778.1

PREDICTED: Mus musculus DENN/MADD domain containing 6A (Dennd6a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dennd6a (211922)
Length:
3949
CDS:
628..1773

Additional Resources:

NCBI RefSeq record:
XM_006518778.1
NBCI Gene record:
Dennd6a (211922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195935 CGGCAGTTTCTAAAGTCTCCA pLKO.1 1462 CDS 100% 2.640 3.696 N Dennd6a n/a
2 TRCN0000292783 CGGCAGTTTCTAAAGTCTCCA pLKO_005 1462 CDS 100% 2.640 3.696 N Dennd6a n/a
3 TRCN0000183280 GCATTCCAAACTTACTGATAA pLKO.1 198 5UTR 100% 13.200 10.560 N Dennd6a n/a
4 TRCN0000298042 GCATTCCAAACTTACTGATAA pLKO_005 198 5UTR 100% 13.200 10.560 N Dennd6a n/a
5 TRCN0000433390 GATCAGCAAACTACCTTATAT pLKO_005 471 5UTR 100% 15.000 10.500 N DENND6A n/a
6 TRCN0000183812 CCTAAGCAAGTTAAAGTGAAA pLKO.1 1087 CDS 100% 4.950 3.465 N Dennd6a n/a
7 TRCN0000298044 CCTAAGCAAGTTAAAGTGAAA pLKO_005 1087 CDS 100% 4.950 3.465 N Dennd6a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09818 pDONR223 100% 56.7% 60.1% None (many diffs) n/a
2 ccsbBroad304_09818 pLX_304 0% 56.7% 60.1% V5 (many diffs) n/a
3 TRCN0000470870 ATCGAAAGGTTTTTACTTCCCAGA pLX_317 19.6% 56.7% 60.1% V5 (many diffs) n/a
Download CSV