Transcript: Mouse XM_006518830.1

PREDICTED: Mus musculus WD repeat and HMG-box DNA binding protein 1 (Wdhd1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdhd1 (218973)
Length:
4280
CDS:
256..3612

Additional Resources:

NCBI RefSeq record:
XM_006518830.1
NBCI Gene record:
Wdhd1 (218973)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085790 GCCGTGCATTTAGCCATTAAA pLKO.1 2608 CDS 100% 15.000 21.000 N Wdhd1 n/a
2 TRCN0000366054 TCCTTCGACTGTTCACTATTG pLKO_005 1892 CDS 100% 10.800 15.120 N Wdhd1 n/a
3 TRCN0000085791 CGCTGCTATAACGACGATCAA pLKO.1 1600 CDS 100% 4.950 6.930 N Wdhd1 n/a
4 TRCN0000085789 CCGTGCATTTAGCCATTAAAT pLKO.1 2609 CDS 100% 1.500 2.100 N Wdhd1 n/a
5 TRCN0000432252 GCTTCTCGCTCTCGGAAATTA pLKO_005 2632 CDS 100% 15.000 12.000 N WDHD1 n/a
6 TRCN0000366052 AGAGCAGCAGGAACTCTTAAT pLKO_005 2511 CDS 100% 13.200 9.240 N Wdhd1 n/a
7 TRCN0000366051 GGGCTTTCCCGCCTTTGTTTA pLKO_005 4031 3UTR 100% 13.200 9.240 N Wdhd1 n/a
8 TRCN0000365978 GTCTCCCTGTGGGCAGTATTT pLKO_005 969 CDS 100% 13.200 9.240 N Wdhd1 n/a
9 TRCN0000374286 TGATTATGAGGAGAGCATTAA pLKO_005 2475 CDS 100% 13.200 9.240 N Wdhd1 n/a
10 TRCN0000365980 TGTGAAAGTGCTGATGAATTA pLKO_005 1735 CDS 100% 13.200 9.240 N Wdhd1 n/a
11 TRCN0000085792 CCTCTGATACACCAGCTCTTA pLKO.1 2903 CDS 100% 4.950 3.465 N Wdhd1 n/a
12 TRCN0000085788 GCTTCCCAAGTGAGATGTCAT pLKO.1 4082 3UTR 100% 4.950 3.465 N Wdhd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.