Transcript: Mouse XM_006518984.2

PREDICTED: Mus musculus C1q and tumor necrosis factor related protein 9 (C1qtnf9), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
C1qtnf9 (239126)
Length:
1798
CDS:
366..953

Additional Resources:

NCBI RefSeq record:
XM_006518984.2
NBCI Gene record:
C1qtnf9 (239126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119463 GAGAGGTTCAATGGCTTATTT pLKO.1 876 CDS 100% 15.000 21.000 N C1qtnf9 n/a
2 TRCN0000425774 GGACTCACGGTGATCAGTAAG pLKO_005 570 CDS 100% 10.800 15.120 N C1qtnf9 n/a
3 TRCN0000119465 CCGAAGGACTAATGGGCAGTA pLKO.1 355 5UTR 100% 4.050 5.670 N C1qtnf9 n/a
4 TRCN0000119462 CCGTCATTTGAACACATGAAT pLKO.1 1113 3UTR 100% 5.625 4.500 N C1qtnf9 n/a
5 TRCN0000119464 GATCCTATACAATGAACTGAA pLKO.1 626 CDS 100% 4.950 3.465 N C1qtnf9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10005 pDONR223 100% 48.7% 50.4% None (many diffs) n/a
2 ccsbBroad304_10005 pLX_304 0% 48.7% 50.4% V5 (many diffs) n/a
3 TRCN0000473757 ATCTTAGTATATGTCATACGGTCC pLX_317 48.2% 48.7% 50.4% V5 (many diffs) n/a
Download CSV