Transcript: Mouse XM_006519065.3

PREDICTED: Mus musculus WD repeat and FYVE domain containing 2 (Wdfy2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdfy2 (268752)
Length:
992
CDS:
104..904

Additional Resources:

NCBI RefSeq record:
XM_006519065.3
NBCI Gene record:
Wdfy2 (268752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519065.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242079 TGGCGGTGATTGTACCTAAAG pLKO_005 189 CDS 100% 10.800 15.120 N Wdfy2 n/a
2 TRCN0000156031 CCATAGGTCTAGACAATGGTA pLKO.1 354 CDS 100% 3.000 4.200 N WDFY2 n/a
3 TRCN0000242078 ATGACAGTAAGCATAACATTG pLKO_005 933 3UTR 100% 10.800 7.560 N Wdfy2 n/a
4 TRCN0000216850 GGTCTAGACAATGGTACAATC pLKO.1 359 CDS 100% 10.800 7.560 N Wdfy2 n/a
5 TRCN0000242080 GGTCTAGACAATGGTACAATC pLKO_005 359 CDS 100% 10.800 7.560 N Wdfy2 n/a
6 TRCN0000156182 CAAGCAAATGTGGGACAGTAA pLKO.1 870 CDS 100% 4.950 3.465 N WDFY2 n/a
7 TRCN0000195876 CAGGACAGTTCGTGTTTGGTT pLKO.1 238 CDS 100% 3.000 2.100 N Wdfy2 n/a
8 TRCN0000178942 CGTCATGTGTTTATTGGCGAT pLKO.1 605 CDS 100% 2.160 1.512 N Wdfy2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519065.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04688 pDONR223 100% 61.6% 51.3% None (many diffs) n/a
2 ccsbBroad304_04688 pLX_304 0% 61.6% 51.3% V5 (many diffs) n/a
3 TRCN0000474486 ACCACCACCCACTCCAGAACCCGG pLX_317 30.7% 61.6% 51.3% V5 (many diffs) n/a
Download CSV