Construct: ORF TRCN0000474486
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002151.1_s317c1
- Derived from:
- ccsbBroadEn_04688
- DNA Barcode:
- ACCACCACCCACTCCAGAACCCGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WDFY2 (115825)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474486
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | NM_052950.4 | 100% | 100% | |
| 2 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XM_011534914.1 | 97.9% | 97.2% | (many diffs) |
| 3 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XM_024449316.1 | 83.5% | 83.5% | 0_1ins198 |
| 4 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XM_024449317.1 | 83.5% | 83.5% | 0_1ins198 |
| 5 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XM_011534915.2 | 77.7% | 76.7% | 0_1ins193;12_13ins74 |
| 6 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XM_017020386.1 | 77.7% | 76.7% | 0_1ins193;12_13ins74 |
| 7 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XR_941489.1 | 59.2% | 1_231del;1063_1186del;1276_1277ins279 | |
| 8 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XR_941483.1 | 56.8% | (many diffs) | |
| 9 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XR_941488.1 | 51.5% | (many diffs) | |
| 10 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XR_941487.1 | 48.5% | (many diffs) | |
| 11 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XR_001749475.1 | 12.6% | 1_231del;829_830ins127;1305_8337del | |
| 12 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XR_941485.2 | 12.3% | 1_231del;1061_2274del;2646_9678del | |
| 13 | human | 115825 | WDFY2 | WD repeat and FYVE domain c... | XR_941484.2 | 11.4% | 1_231del;1061_3036del;3408_10440del | |
| 14 | mouse | 268752 | Wdfy2 | WD repeat and FYVE domain c... | NM_175546.4 | 92.5% | 98.2% | (many diffs) |
| 15 | mouse | 268752 | Wdfy2 | WD repeat and FYVE domain c... | XR_001781124.1 | 76.5% | (many diffs) | |
| 16 | mouse | 268752 | Wdfy2 | WD repeat and FYVE domain c... | XM_006519063.3 | 73.6% | 76.5% | (many diffs) |
| 17 | mouse | 268752 | Wdfy2 | WD repeat and FYVE domain c... | XM_006519064.1 | 71.7% | 75.7% | (many diffs) |
| 18 | mouse | 268752 | Wdfy2 | WD repeat and FYVE domain c... | XM_006519065.3 | 61.6% | 51.3% | (many diffs) |
| 19 | mouse | 268752 | Wdfy2 | WD repeat and FYVE domain c... | XR_383185.3 | 15.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1266
- ORF length:
- 1200
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcggagatc cagcccaagc ctctgacccg caagccgatc ctgctgcagc 121 ggatggaggg gtcccaggag gtggtgaata tggccgtgat cgtgcccaaa gaggagggcg 181 tcatcagcgt ctccgaggac aggacagttc gtgtttggtt aaagagagac agtggacagt 241 attggccaag cgtataccat gcaatgcctt ctccatgttc atgcatgtct tttaacccgg 301 aaacaagaag actgtccata ggtctagaca atggtacaat ctcagagttt atattgtcag 361 aagattataa caagatgact cctgtgaaaa actatcaagc gcatcagagc agagtgacga 421 tgatcctgtt tgtcctggag ctggagtggg tgctgagcac aggacaggac aagcaatttg 481 cctggcactg ctctgagagt gggcagcgcc tgggaggtta tcggaccagt gctgtggcct 541 caggcctgca atttgatgtt gaaacccggc atgtgtttat cggtgaccac tcaggccaag 601 taacaatcct caaactggag caagaaaact gcaccctggt cacaacattc agaggacaca 661 caggtggggt gaccgctctc tgttgggacc cagtccagcg ggtgttgttc tcaggcagtt 721 cagatcactc tgtcatcatg tgggacatcg gtgggagaaa aggaacagcc atcgagctcc 781 aaggacacaa cgacagagtc caggccctct cctatgcaca gcacacgcga caattgatct 841 cctgtggcgg tgatggtggg attgtcgtct ggaacatgga cgtggagagg caggagaccc 901 cTGAATGGTT GGACAGTGAT TCCTGCCAAA AGTGTGATCA GCCTTTCTTC TGGAACTTCA 961 AGCAAATGTG GGACAGTAAG AAAATTGGTC TAAGACAGCA CCACTGCCGC AAGTGTGGGA 1021 AGGCCGTCTG TGGCAAGTGC AGCTCCAAGC GCTCCTCCAT CCCCCTGATG GGCTTCGAGT 1081 TTGAAGTGAG GGTCTGTGAC AGCTGCCACG AGGCCATCAC AGATGAAGAA CGTGCACCCA 1141 CAGCCACCTT CCATGACAGT AAACATAACA TTGTGCATGT GCATTTCGAT GCAACCAGAG 1201 GATGGTTACT GACTTCTGGA ACTGACAAGG TTATTAAGTT GTGGGATATG ACCCCAGTCG 1261 TGTCTTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1321 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1381 CTTGGCTTTA TATATCTTGT GGAAAGGACG AACCACCACC CACTCCAGAA CCCGGACGCG 1441 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt