Transcript: Mouse XM_006519076.3

PREDICTED: Mus musculus dual specificity phosphatase 13 (Dusp13), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dusp13 (27389)
Length:
1115
CDS:
265..861

Additional Resources:

NCBI RefSeq record:
XM_006519076.3
NBCI Gene record:
Dusp13 (27389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305354 GTGAGTCGCTCTGCCACAATT pLKO_005 688 CDS 100% 13.200 18.480 N Dusp13 n/a
2 TRCN0000081029 GTTGCTCGTTACATCAGAGAT pLKO.1 619 CDS 100% 4.950 3.960 N Dusp13 n/a
3 TRCN0000309702 GTTGCTCGTTACATCAGAGAT pLKO_005 619 CDS 100% 4.950 3.960 N Dusp13 n/a
4 TRCN0000305355 ATCCAGCGTGGCCTAACCTGA pLKO_005 893 3UTR 100% 0.880 0.704 N Dusp13 n/a
5 TRCN0000081031 CCTCTGGAGTACTATGGCATT pLKO.1 550 CDS 100% 4.050 2.835 N Dusp13 n/a
6 TRCN0000309805 CCTCTGGAGTACTATGGCATT pLKO_005 550 CDS 100% 4.050 2.835 N Dusp13 n/a
7 TRCN0000081032 CGAGATATCTGTCCCAACTCA pLKO.1 778 CDS 100% 3.000 2.100 N Dusp13 n/a
8 TRCN0000331982 CGAGATATCTGTCCCAACTCA pLKO_005 778 CDS 100% 3.000 2.100 N Dusp13 n/a
9 TRCN0000081030 GCCAGAGACAAGGGTCGTCTA pLKO.1 445 CDS 100% 1.350 0.945 N Dusp13 n/a
10 TRCN0000081028 GCCTCTGCTGTTTCCAGAGAT pLKO.1 937 3UTR 100% 0.495 0.297 N Dusp13 n/a
11 TRCN0000416424 AGCTCCAGGTTCTGGACAACC pLKO_005 812 CDS 100% 1.350 0.945 N DUSP13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08254 pDONR223 100% 86.1% 87.3% None (many diffs) n/a
2 ccsbBroad304_08254 pLX_304 0% 86.1% 87.3% V5 (many diffs) n/a
3 TRCN0000469415 TGTTGGAGTTATTTGGACCTATGA pLX_317 80.7% 86.1% 87.3% V5 (many diffs) n/a
Download CSV