Transcript: Mouse XM_006519132.3

PREDICTED: Mus musculus V-set and transmembrane domain containing 4 (Vstm4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vstm4 (320736)
Length:
879
CDS:
151..840

Additional Resources:

NCBI RefSeq record:
XM_006519132.3
NBCI Gene record:
Vstm4 (320736)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519132.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174443 CGAAGATTCATCATTTGAGAA pLKO.1 624 CDS 100% 4.950 6.930 N Vstm4 n/a
2 TRCN0000174016 CGACGGAAATGAGAGTGATCT pLKO.1 590 CDS 100% 4.950 6.930 N Vstm4 n/a
3 TRCN0000194117 GAGTGAGACATTATTTGGTGA pLKO.1 779 CDS 100% 2.640 1.848 N Vstm4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519132.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09793 pDONR223 100% 60.9% 60.5% None (many diffs) n/a
2 ccsbBroad304_09793 pLX_304 0% 60.9% 60.5% V5 (many diffs) n/a
3 TRCN0000478079 ACTGGCAACTAAAAAACCGACCGT pLX_317 33.8% 60.9% 60.5% V5 (many diffs) n/a
Download CSV