Construct: ORF TRCN0000478079
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008146.1_s317c1
- Derived from:
- ccsbBroadEn_09793
- DNA Barcode:
- ACTGGCAACTAAAAAACCGACCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VSTM4 (196740)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478079
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 196740 | VSTM4 | V-set and transmembrane dom... | NM_001031746.5 | 99.4% | 99% | (many diffs) |
2 | human | 196740 | VSTM4 | V-set and transmembrane dom... | XM_017015827.2 | 87.9% | 83.5% | (many diffs) |
3 | human | 196740 | VSTM4 | V-set and transmembrane dom... | XM_017015826.1 | 83.7% | 73.9% | (many diffs) |
4 | human | 196740 | VSTM4 | V-set and transmembrane dom... | XM_017015825.2 | 82.5% | 75.4% | (many diffs) |
5 | human | 196740 | VSTM4 | V-set and transmembrane dom... | XM_017015828.1 | 76.5% | 76.5% | (many diffs) |
6 | human | 196740 | VSTM4 | V-set and transmembrane dom... | NM_144984.4 | 55% | 48.3% | (many diffs) |
7 | human | 196740 | VSTM4 | V-set and transmembrane dom... | XR_001747052.2 | 16.5% | (many diffs) | |
8 | mouse | 320736 | Vstm4 | V-set and transmembrane dom... | NM_178791.4 | 85.7% | 86.6% | (many diffs) |
9 | mouse | 320736 | Vstm4 | V-set and transmembrane dom... | XM_006519132.3 | 60.9% | 60.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1026
- ORF length:
- 960
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg gctgctggca ctggcggcgg ccgcgctgct ggcgcgggct ccggctccgg 121 aggtctgtgt ggccctcaat gtcactgtgt ccccggggcc cgtggttgac tacctggagg 181 gggagaatgc cactctcctc tgccacgtct cccagaaaag gcggaaggac agcttgctgg 241 ccgtgcgctg gttctttgca cactcctccg actcccagga ggccttgatg gtgaagatga 301 ccaagctccg ggtggtgcag tactatggga atttcagccg cagcgccaaa cggcggaggc 361 tgcgcctgct ggaggagcag cggggggcgc tctacaggct ctccgtcttg acactgcagc 421 cctccgatca agggcattac gtctgcagag tccaggaaat cagcaggcac aggaacaagt 481 ggacggcctg gtccaatggc tcctcagcca cggaaatgag agtcatttcc ctcaaagctt 541 ctgaagagtc atcctttgag aaaacaaaag agacttgggc attttttgaa gatctctatg 601 tgtatgctgt cctcgtgtgc tgcgtgggga tcctcagcat tctgctcttc atgctggtca 661 tcgtctggca gtctgtgttt aacaagcgga aatccagagt gagaCATTAT TTGGTGAAAT 721 GCCCTCAGAA CAGCTCAGGG GAGACTGTCA CTAGCGTGAC CAGCTTGGCC CCACTACAGC 781 CCAAGAAGGG CAGGAGGCAG AAGGAGAAGC CTGACATTCC TCCAGCAGTC CCTGCCAAAG 841 CTCCGATAGC CCCCACGTTC CATAAACCGA AGCTGCTGAA ACCACAGAGA AAAGTCACGC 901 TGCCAAAGAT TGCTGAGGAA AACTTAACCT ATGCCGAGCT GGAGCTGATC AAACCCCACC 961 GGGCTGCCAA AGGCGCCCCC ACCAGCACTG TCTACGCCCA GATCCTCTTC GAGGAGAACA 1021 AGCTGTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1081 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1141 CTTGGCTTTA TATATCTTGT GGAAAGGACG AACTGGCAAC TAAAAAACCG ACCGTACGCG 1201 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt