Transcript: Mouse XM_006519154.3

PREDICTED: Mus musculus leucine-rich repeats and calponin homology (CH) domain containing 1 (Lrch1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrch1 (380916)
Length:
4313
CDS:
264..2594

Additional Resources:

NCBI RefSeq record:
XM_006519154.3
NBCI Gene record:
Lrch1 (380916)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251152 TCGGGACTTATGAACTATATT pLKO_005 1446 CDS 100% 15.000 21.000 N Lrch1 n/a
2 TRCN0000251153 GTTCGGGCAGATCTATCTAAA pLKO_005 531 CDS 100% 13.200 18.480 N Lrch1 n/a
3 TRCN0000251154 CAACGGTCTAAGCGCAGATAT pLKO_005 1616 CDS 100% 13.200 9.240 N Lrch1 n/a
4 TRCN0000130888 GACCTTATAGGCTTCTGTCTT pLKO.1 2511 CDS 100% 4.950 3.465 N LRCH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07841 pDONR223 100% 81.8% 83.4% None (many diffs) n/a
2 ccsbBroad304_07841 pLX_304 0% 81.8% 83.4% V5 (many diffs) n/a
3 TRCN0000466610 GGATCTTAATCTCCTCTTCAGGCG pLX_317 15.6% 81.8% 83.4% V5 (many diffs) n/a
Download CSV