Transcript: Mouse XM_006519193.3

PREDICTED: Mus musculus collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (Colq), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Colq (382864)
Length:
3387
CDS:
716..2059

Additional Resources:

NCBI RefSeq record:
XM_006519193.3
NBCI Gene record:
Colq (382864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519193.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253455 ACCTATCTCCCTGGATCATAC pLKO_005 1976 CDS 100% 10.800 15.120 N Colq n/a
2 TRCN0000253456 CCTACTGTGGAGACGGTTACC pLKO_005 1899 CDS 100% 1.350 1.080 N Colq n/a
3 TRCN0000265394 TGGCCAGAGCCTGGATCAATT pLKO_005 2608 3UTR 100% 13.200 9.240 N Colq n/a
4 TRCN0000253458 ACTGTGACGGCTCTGACTTTG pLKO_005 1938 CDS 100% 10.800 7.560 N Colq n/a
5 TRCN0000048707 GAAAGGTGAAATGGGTCCAAA pLKO.1 1315 CDS 100% 4.950 3.465 N COLQ n/a
6 TRCN0000253457 GATGGCTGCATCGACTGTCAT pLKO_005 1874 CDS 100% 4.950 3.465 N Colq n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519193.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07215 pDONR223 100% 84.8% 82.8% None (many diffs) n/a
2 ccsbBroad304_07215 pLX_304 0% 84.8% 82.8% V5 (many diffs) n/a
3 TRCN0000476005 ATTAGTTGGATGTCATCCGAGCAT pLX_317 12% 84.8% 82.8% V5 (many diffs) n/a
Download CSV