Transcript: Mouse XM_006519276.3

PREDICTED: Mus musculus glucosamine-phosphate N-acetyltransferase 1 (Gnpnat1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gnpnat1 (54342)
Length:
2487
CDS:
34..588

Additional Resources:

NCBI RefSeq record:
XM_006519276.3
NBCI Gene record:
Gnpnat1 (54342)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114595 CGGAACAGTTCATGAAATCTT pLKO.1 236 CDS 100% 5.625 7.875 N Gnpnat1 n/a
2 TRCN0000324410 CGGAACAGTTCATGAAATCTT pLKO_005 236 CDS 100% 5.625 7.875 N Gnpnat1 n/a
3 TRCN0000114593 GAGTCAGAATACAGCTATATT pLKO.1 90 CDS 100% 15.000 10.500 N Gnpnat1 n/a
4 TRCN0000324411 GAGTCAGAATACAGCTATATT pLKO_005 90 CDS 100% 15.000 10.500 N Gnpnat1 n/a
5 TRCN0000034620 CCCTTGAATGTCTACCACAAA pLKO.1 494 CDS 100% 4.950 3.465 N GNPNAT1 n/a
6 TRCN0000114594 GAGTAGAAGATGTCGTCGTTA pLKO.1 386 CDS 100% 4.950 3.465 N Gnpnat1 n/a
7 TRCN0000324342 GAGTAGAAGATGTCGTCGTTA pLKO_005 386 CDS 100% 4.950 3.465 N Gnpnat1 n/a
8 TRCN0000114592 GCAACTCTGATAATAGAACAT pLKO.1 334 CDS 100% 4.950 3.465 N Gnpnat1 n/a
9 TRCN0000324343 GCAACTCTGATAATAGAACAT pLKO_005 334 CDS 100% 4.950 3.465 N Gnpnat1 n/a
10 TRCN0000114591 CCATTGACATTTGAAGCCTTT pLKO.1 1227 3UTR 100% 4.050 2.835 N Gnpnat1 n/a
11 TRCN0000324409 CCATTGACATTTGAAGCCTTT pLKO_005 1227 3UTR 100% 4.050 2.835 N Gnpnat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03977 pDONR223 100% 91.6% 98.3% None (many diffs) n/a
2 ccsbBroad304_03977 pLX_304 0% 91.6% 98.3% V5 (many diffs) n/a
3 TRCN0000474499 TGAGGTGAACGATCACGCCTAATT pLX_317 91.9% 91.6% 98.3% V5 (many diffs) n/a
Download CSV