Transcript: Mouse XM_006519289.4

PREDICTED: Mus musculus Scm-like with four mbt domains 1 (Sfmbt1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Sfmbt1 (54650)
Length:
7638
CDS:
182..2773

Additional Resources:

NCBI RefSeq record:
XM_006519289.4
NBCI Gene record:
Sfmbt1 (54650)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519289.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340825 ACCAAATACACGCACTATTAT pLKO_005 2069 CDS 100% 15.000 21.000 N Sfmbt1 n/a
2 TRCN0000340826 AGAAGCCTGTACCCGAATTTA pLKO_005 1440 CDS 100% 15.000 21.000 N Sfmbt1 n/a
3 TRCN0000340762 GTTCCCTACGCATCGTTTAAA pLKO_005 281 CDS 100% 15.000 21.000 N Sfmbt1 n/a
4 TRCN0000352466 GACCATACAAGGCGATCATTT pLKO_005 1124 CDS 100% 13.200 18.480 N Sfmbt1 n/a
5 TRCN0000097720 CGAGGGCATAAACTGAGGAAA pLKO.1 1544 CDS 100% 4.950 6.930 N Sfmbt1 n/a
6 TRCN0000191060 CTAGCTCAAGTCACAATTATT pLKO.1 7174 3UTR 100% 15.000 12.000 N Sfmbt1 n/a
7 TRCN0000097723 CAAACTAGAATGCCAGGATTT pLKO.1 679 CDS 100% 10.800 8.640 N Sfmbt1 n/a
8 TRCN0000201468 CTACCTATTGACCTGGAGTTT pLKO.1 6639 3UTR 100% 4.950 3.960 N Sfmbt1 n/a
9 TRCN0000193000 GTCTAGCTCAAGTCACAATTA pLKO.1 7172 3UTR 100% 13.200 9.240 N Sfmbt1 n/a
10 TRCN0000340761 CAACGATTGCTAAGGTGTTTG pLKO_005 1059 CDS 100% 10.800 7.560 N Sfmbt1 n/a
11 TRCN0000191059 CGCTGTGTTTAAGAAATCAAA pLKO.1 6834 3UTR 100% 5.625 3.938 N Sfmbt1 n/a
12 TRCN0000097721 CCAAACTAGAATGCCAGGATT pLKO.1 678 CDS 100% 4.950 3.465 N Sfmbt1 n/a
13 TRCN0000097722 CCATGCTAACAGTCCTGGTAT pLKO.1 1150 CDS 100% 4.950 3.465 N Sfmbt1 n/a
14 TRCN0000097724 GCACTATTATGGAAAGAAGAA pLKO.1 2080 CDS 100% 4.950 3.465 N Sfmbt1 n/a
15 TRCN0000190422 CAAAGTCCAGTCCAAATGGAT pLKO.1 6680 3UTR 100% 3.000 2.100 N Sfmbt1 n/a
16 TRCN0000147760 GCTACTGTTGAGATAGTGAAA pLKO.1 1925 CDS 100% 4.950 3.465 N SFMBT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519289.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.