Transcript: Mouse XM_006519316.2

PREDICTED: Mus musculus stathmin-like 4 (Stmn4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stmn4 (56471)
Length:
1438
CDS:
189..800

Additional Resources:

NCBI RefSeq record:
XM_006519316.2
NBCI Gene record:
Stmn4 (56471)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163179 GACCAGTGAAGCCATCCTATT pLKO.1 1057 3UTR 100% 10.800 7.560 N STMN4 n/a
2 TRCN0000115530 CATCTCTGATATGGAAGTCAT pLKO.1 407 CDS 100% 4.950 3.465 N Stmn4 n/a
3 TRCN0000115529 CCCATCATTAGAAGAGATTCA pLKO.1 533 CDS 100% 4.950 3.465 N Stmn4 n/a
4 TRCN0000115527 CCTGAATAAATCATCCTACAA pLKO.1 269 CDS 100% 4.950 3.465 N Stmn4 n/a
5 TRCN0000115526 CGAGTGGAGAGAAGATGAGAA pLKO.1 1241 3UTR 100% 4.950 3.465 N Stmn4 n/a
6 TRCN0000115528 GACCCATCATTAGAAGAGATT pLKO.1 531 CDS 100% 4.950 3.465 N Stmn4 n/a
7 TRCN0000162193 CCTACAAATATGAAGGCTGGT pLKO.1 283 CDS 100% 2.160 1.512 N STMN4 n/a
8 TRCN0000160910 GAAGTCATCGAGCTGAACAAA pLKO.1 420 CDS 100% 5.625 3.938 N STMN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04236 pDONR223 100% 82.4% 89.3% None (many diffs) n/a
2 ccsbBroad304_04236 pLX_304 0% 82.4% 89.3% V5 (many diffs) n/a
3 TRCN0000472188 TTGCTGTTCCCCCGCACCTGTGTG pLX_317 58.6% 82.4% 89.3% V5 (many diffs) n/a
Download CSV