Transcript: Mouse XM_006519393.2

PREDICTED: Mus musculus paraspeckle protein 1 (Pspc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pspc1 (66645)
Length:
1761
CDS:
235..1107

Additional Resources:

NCBI RefSeq record:
XM_006519393.2
NBCI Gene record:
Pspc1 (66645)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295198 TTAGCTAATCCTACCTATTTA pLKO_005 1465 3UTR 100% 15.000 21.000 N Pspc1 n/a
2 TRCN0000102474 CCCTAATAAGCGTCGGAGATA pLKO.1 1083 CDS 100% 4.950 6.930 N Pspc1 n/a
3 TRCN0000287873 CCCTAATAAGCGTCGGAGATA pLKO_005 1083 CDS 100% 4.950 6.930 N Pspc1 n/a
4 TRCN0000102473 CTAGACATGAACACCAGTTAA pLKO.1 464 CDS 100% 13.200 10.560 N Pspc1 n/a
5 TRCN0000287740 CTAGACATGAACACCAGTTAA pLKO_005 464 CDS 100% 13.200 10.560 N Pspc1 n/a
6 TRCN0000295149 GCTAATGAGGCAAGATCTAAT pLKO_005 486 CDS 100% 13.200 9.240 N Pspc1 n/a
7 TRCN0000102471 CCTGGGACATTTGAATTTGAA pLKO.1 334 CDS 100% 5.625 3.938 N Pspc1 n/a
8 TRCN0000102470 CCCATCATTGTGAATGTTGAA pLKO.1 1294 3UTR 100% 4.950 3.465 N Pspc1 n/a
9 TRCN0000102472 GCTAGACATGAACACCAGTTA pLKO.1 463 CDS 100% 4.950 3.465 N Pspc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10243 pDONR223 100% 27.7% 29.1% None (many diffs) n/a
2 ccsbBroad304_10243 pLX_304 0% 27.7% 29.1% V5 (many diffs) n/a
3 TRCN0000478484 GGCGCCTTGTGGTGGTGCCAATAA pLX_317 29.6% 27.7% 29.1% V5 (many diffs) n/a
Download CSV