Transcript: Mouse XM_006519446.3

PREDICTED: Mus musculus zinc finger CCCH type containing 13 (Zc3h13), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zc3h13 (67302)
Length:
6228
CDS:
367..5559

Additional Resources:

NCBI RefSeq record:
XM_006519446.3
NBCI Gene record:
Zc3h13 (67302)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217812 CGGCTAAGTCTTCGGTTATTT pLKO.1 5443 CDS 100% 15.000 21.000 N Zc3h13 n/a
2 TRCN0000217068 CATGAGGATAGTCAGGTATTT pLKO.1 3550 CDS 100% 13.200 9.240 N Zc3h13 n/a
3 TRCN0000175713 GAAAGGCTACAGCAGCAATTA pLKO.1 567 CDS 100% 13.200 9.240 N Zc3h13 n/a
4 TRCN0000216806 GACACGTGCTTTGGTTCATTT pLKO.1 5702 3UTR 100% 13.200 9.240 N Zc3h13 n/a
5 TRCN0000175152 GATTCTGACAATGGAGATATT pLKO.1 814 CDS 100% 13.200 9.240 N Zc3h13 n/a
6 TRCN0000175457 CCAAGACCATATCTGAGAGTA pLKO.1 404 CDS 100% 4.950 3.465 N Zc3h13 n/a
7 TRCN0000018239 CCAAGTTAGATGATGCACATT pLKO.1 4886 CDS 100% 4.950 3.465 N ZC3H13 n/a
8 TRCN0000176014 GAATCTTCAAGAGGGAGACAT pLKO.1 709 CDS 100% 4.950 3.465 N Zc3h13 n/a
9 TRCN0000175397 CTTCTAGACATCACTCGTCAT pLKO.1 1346 CDS 100% 4.050 2.835 N Zc3h13 n/a
10 TRCN0000173548 GCTGCCTCTATGGAAACACAT pLKO.1 515 CDS 100% 4.950 2.970 N Zc3h13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.