Transcript: Mouse XM_006519551.3

PREDICTED: Mus musculus testis-specific serine kinase 4 (Tssk4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tssk4 (71099)
Length:
1097
CDS:
210..1010

Additional Resources:

NCBI RefSeq record:
XM_006519551.3
NBCI Gene record:
Tssk4 (71099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361793 CTCGAATGGATCCAACGATAT pLKO_005 324 CDS 100% 10.800 15.120 N Tssk4 n/a
2 TRCN0000024240 CCTCGAATGGATCCAACGATA pLKO.1 323 CDS 100% 4.950 6.930 N Tssk4 n/a
3 TRCN0000024241 CTGTGCATAGTAGCCCTTCTT pLKO.1 556 CDS 100% 4.950 3.960 N Tssk4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13502 pDONR223 100% 84.6% 81.9% None (many diffs) n/a
2 ccsbBroad304_13502 pLX_304 0% 84.6% 81.9% V5 (many diffs) n/a
3 TRCN0000474270 ACCTGAGATACATACTTGTATTAA pLX_317 29.7% 84.6% 81.9% V5 (many diffs) n/a
Download CSV