Transcript: Mouse XM_006519744.2

PREDICTED: Mus musculus lysyl oxidase-like 2 (Loxl2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Loxl2 (94352)
Length:
5333
CDS:
267..2618

Additional Resources:

NCBI RefSeq record:
XM_006519744.2
NBCI Gene record:
Loxl2 (94352)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076708 GCTGAGAAGAAAGGTGCTCAT pLKO.1 2896 3UTR 100% 4.050 2.835 N Loxl2 n/a
2 TRCN0000076711 CCAAATAGAGAGCCTAAATAT pLKO.1 797 CDS 100% 15.000 7.500 Y Loxl2 n/a
3 TRCN0000076712 CAACCAAATAGAGAGCCTAAA pLKO.1 794 CDS 100% 10.800 5.400 Y Loxl2 n/a
4 TRCN0000076710 CCTGGTGCTTAATGCTGAGAT pLKO.1 1940 CDS 100% 4.950 2.475 Y Loxl2 n/a
5 TRCN0000076709 GCATGGAAATATCTTCGCCAA pLKO.1 1781 CDS 100% 2.160 1.080 Y Loxl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489515 TGGACACTCACAATCAATGCAGAT pLX_317 12.7% 83.3% 85.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488025 TTGTTCGGACCCTTCATACATCTA pLX_317 13.1% 83.3% 85.3% V5 (many diffs) n/a
Download CSV