Transcript: Mouse XM_006520187.2

PREDICTED: Mus musculus retinoic acid induced 14 (Rai14), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rai14 (75646)
Length:
4759
CDS:
94..3033

Additional Resources:

NCBI RefSeq record:
XM_006520187.2
NBCI Gene record:
Rai14 (75646)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520187.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255955 CGAACACTGTGGACGCCTTAA pLKO_005 686 CDS 100% 10.800 15.120 N Rai14 n/a
2 TRCN0000085500 CGCTTCCCTTACCTTACACAA pLKO.1 1161 CDS 100% 4.950 6.930 N Rai14 n/a
3 TRCN0000085499 GCGAAGTCAATGCCTTAGCAA pLKO.1 2483 CDS 100% 3.000 4.200 N Rai14 n/a
4 TRCN0000255951 ATCACGGCGCAGATGTCAATT pLKO_005 611 CDS 100% 13.200 10.560 N Rai14 n/a
5 TRCN0000085498 CGACCTTACTTTCAGGTTGAA pLKO.1 4160 3UTR 100% 4.950 3.960 N Rai14 n/a
6 TRCN0000255952 ACTGCTCTGTTATCGAGAATA pLKO_005 1841 CDS 100% 13.200 9.240 N Rai14 n/a
7 TRCN0000255953 AGGATTTGCCACGGGACTTAA pLKO_005 4496 3UTR 100% 13.200 9.240 N Rai14 n/a
8 TRCN0000085502 GCTGACAGCTTGTTGGATATA pLKO.1 1090 CDS 100% 13.200 9.240 N Rai14 n/a
9 TRCN0000255954 GAAACTGAAGGACACGCTAAA pLKO_005 1920 CDS 100% 10.800 7.560 N Rai14 n/a
10 TRCN0000085501 GCAGCCGAGTACATTCACAAA pLKO.1 2104 CDS 100% 4.950 3.465 N Rai14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520187.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07983 pDONR223 100% 83.5% 85.1% None (many diffs) n/a
2 ccsbBroad304_07983 pLX_304 0% 83.5% 85.1% V5 (many diffs) n/a
Download CSV