Transcript: Mouse XM_006520248.3

PREDICTED: Mus musculus small G protein signaling modulator 3 (Sgsm3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgsm3 (105835)
Length:
2839
CDS:
218..2500

Additional Resources:

NCBI RefSeq record:
XM_006520248.3
NBCI Gene record:
Sgsm3 (105835)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520248.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106024 CCCTGTTTGAACACGGATTGA pLKO.1 1956 CDS 100% 4.950 6.930 N Sgsm3 n/a
2 TRCN0000106022 GCCTCGCTTAGACAAACTGTT pLKO.1 1024 CDS 100% 4.950 3.960 N Sgsm3 n/a
3 TRCN0000106023 CCTGGTGCTCTGTAAGACATA pLKO.1 2077 CDS 100% 4.950 3.465 N Sgsm3 n/a
4 TRCN0000106020 CCCATCATAGACTGCCTGGAA pLKO.1 2536 3UTR 100% 2.640 1.848 N Sgsm3 n/a
5 TRCN0000106021 GCCTACCTTATTGCAGACCAA pLKO.1 1370 CDS 100% 2.640 1.848 N Sgsm3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520248.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03039 pDONR223 100% 87.1% 92.5% None (many diffs) n/a
2 ccsbBroad304_03039 pLX_304 0% 87.1% 92.5% V5 (many diffs) n/a
3 TRCN0000470240 AATCAGGGATAGATAGATAACCTT pLX_317 22.5% 87.1% 92.5% V5 (many diffs) n/a
Download CSV