Transcript: Mouse XM_006520406.3

PREDICTED: Mus musculus desert hedgehog (Dhh), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dhh (13363)
Length:
2553
CDS:
797..1645

Additional Resources:

NCBI RefSeq record:
XM_006520406.3
NBCI Gene record:
Dhh (13363)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031069 CCGTAATAAGTATGGTTTGTT pLKO.1 919 CDS 100% 5.625 7.875 N Dhh n/a
2 TRCN0000031071 CACATCCACGTATCGGTCAAA pLKO.1 995 CDS 100% 4.950 6.930 N Dhh n/a
3 TRCN0000031072 CAGGATTCACTCCACTACGAA pLKO.1 863 CDS 100% 3.000 2.100 N Dhh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03155 pDONR223 100% 63.2% 69.6% None (many diffs) n/a
2 ccsbBroad304_03155 pLX_304 0% 63.2% 69.6% V5 (many diffs) n/a
3 TRCN0000476757 TGCTCGCTCCCCGGGTTGCCTTGT pLX_317 31.8% 63.2% 69.6% V5 (many diffs) n/a
Download CSV