Transcript: Mouse XM_006520555.1

PREDICTED: Mus musculus mannoside acetylglucosaminyltransferase 3 (Mgat3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mgat3 (17309)
Length:
4630
CDS:
85..1701

Additional Resources:

NCBI RefSeq record:
XM_006520555.1
NBCI Gene record:
Mgat3 (17309)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018459 GCGGGTTATCAACGCCATCAA pLKO.1 714 CDS 100% 4.950 6.930 N Mgat3 n/a
2 TRCN0000035780 GTACTACACCATGCCCAACTT pLKO.1 1251 CDS 100% 4.950 3.465 N MGAT3 n/a
3 TRCN0000018457 GCTCAAGAACTATGACCAGTT pLKO.1 1557 CDS 100% 4.050 2.835 N Mgat3 n/a
4 TRCN0000018456 CCTCAATTACATCCGCAGCTT pLKO.1 1449 CDS 100% 2.640 1.848 N Mgat3 n/a
5 TRCN0000018847 CCTGCACTTCTTTAAGACCTT pLKO.1 150 CDS 100% 2.640 1.848 N Mgat3 n/a
6 TRCN0000018458 CCTGTATGGTTTCTTCTGGAA pLKO.1 1137 CDS 100% 2.640 1.848 N Mgat3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01006 pDONR223 100% 85.9% 92.3% None (many diffs) n/a
2 ccsbBroad304_01006 pLX_304 0% 85.9% 92.3% V5 (many diffs) n/a
3 TRCN0000479948 TATGACATTGGACCAAAACCCTAC pLX_317 23.3% 85.9% 92.3% V5 (many diffs) n/a
Download CSV