Transcript: Mouse XM_006520696.1

PREDICTED: Mus musculus solute carrier family 22 (organic cation transporter), member 22 (Slc22a22), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc22a22 (210463)
Length:
2015
CDS:
86..1750

Additional Resources:

NCBI RefSeq record:
XM_006520696.1
NBCI Gene record:
Slc22a22 (210463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000448316 GATCAGCAGTTACGGATATAT pLKO_005 1828 3UTR 100% 15.000 21.000 N Slc22a22 n/a
2 TRCN0000102076 CCAGTAAATCACTCACATATT pLKO.1 1254 CDS 100% 13.200 18.480 N Slc22a22 n/a
3 TRCN0000102077 CCCAGTAAATCACTCACATAT pLKO.1 1253 CDS 100% 13.200 18.480 N Slc22a22 n/a
4 TRCN0000439186 TGTATTACCATCACCATATTC pLKO_005 1337 CDS 100% 13.200 9.240 N Slc22a22 n/a
5 TRCN0000102078 CCGTCGTCCTTTAATTGCTTT pLKO.1 1294 CDS 100% 4.950 3.465 N Slc22a22 n/a
6 TRCN0000102079 CTGTAGTATAAACCTTGACAA pLKO.1 229 CDS 100% 4.950 3.465 N Slc22a22 n/a
7 TRCN0000102075 CCATCCATATAAAGACTCTTT pLKO.1 1774 3UTR 100% 4.950 2.970 N Slc22a22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.