Transcript: Mouse XM_006520850.1

PREDICTED: Mus musculus periphilin 1 (Pphln1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pphln1 (223828)
Length:
4266
CDS:
286..1521

Additional Resources:

NCBI RefSeq record:
XM_006520850.1
NBCI Gene record:
Pphln1 (223828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520850.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427002 GGATCCACGGCACCCTTATTT pLKO_005 1189 CDS 100% 15.000 21.000 N Pphln1 n/a
2 TRCN0000429630 CAATTCGTGGAAGAGGTAAAG pLKO_005 971 CDS 100% 10.800 15.120 N Pphln1 n/a
3 TRCN0000126505 CCCGAGTCAAACACAGTAGAT pLKO.1 1228 CDS 100% 4.950 6.930 N Pphln1 n/a
4 TRCN0000126508 GACGAAAGTAACTTGGCTGAA pLKO.1 1150 CDS 100% 4.050 5.670 N Pphln1 n/a
5 TRCN0000414975 ATGGCTAAGAGATGATCATTC pLKO_005 672 CDS 100% 10.800 7.560 N Pphln1 n/a
6 TRCN0000437242 GGCAGAACTTACACGAGATAG pLKO_005 1421 CDS 100% 10.800 7.560 N Pphln1 n/a
7 TRCN0000126506 CCAAAGAGATTGAGCAGGTTT pLKO.1 1310 CDS 100% 4.950 3.465 N Pphln1 n/a
8 TRCN0000126507 ACACTAGAGAAGTCAGACGAA pLKO.1 1135 CDS 100% 2.640 1.848 N Pphln1 n/a
9 TRCN0000126504 CCTTGGATTGTGTAAATCCTT pLKO.1 1569 3UTR 100% 0.300 0.150 Y Pphln1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520850.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.