Transcript: Mouse XM_006520899.1

PREDICTED: Mus musculus lymphocyte antigen 6 complex, locus H (Ly6h), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ly6h (23934)
Length:
1505
CDS:
725..1144

Additional Resources:

NCBI RefSeq record:
XM_006520899.1
NBCI Gene record:
Ly6h (23934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099842 CGCGCCTCTTTCAGGCCCTAT pLKO.1 698 5UTR 100% 0.000 0.000 N Ly6h n/a
2 TRCN0000099844 CGACGTGGACTGCTGCGAGAA pLKO.1 1021 CDS 100% 0.000 0.000 N Ly6h n/a
3 TRCN0000099843 CATTAACTCTGGGATCTTAAA pLKO.1 997 CDS 100% 13.200 9.240 N Ly6h n/a
4 TRCN0000099841 GAAGGATCATTCTGTGAACAA pLKO.1 913 CDS 100% 4.950 3.465 N Ly6h n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06544 pDONR223 100% 89% 92.1% None (many diffs) n/a
2 ccsbBroad304_06544 pLX_304 0% 89% 92.1% V5 (many diffs) n/a
3 TRCN0000466996 AACTTACCAGCTTGCCCCCCGTCA pLX_317 90.6% 89% 92.1% V5 (many diffs) n/a
Download CSV