Transcript: Mouse XM_006520926.3

PREDICTED: Mus musculus PHD finger protein 20-like 1 (Phf20l1), transcript variant X18, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phf20l1 (239510)
Length:
2513
CDS:
364..1221

Additional Resources:

NCBI RefSeq record:
XM_006520926.3
NBCI Gene record:
Phf20l1 (239510)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226146 CCGTTCCAAAGATCGTCTTTC pLKO_005 1022 CDS 100% 10.800 15.120 N Phf20l1 n/a
2 TRCN0000226144 GAGCGCTGGAGTCATCGATAT pLKO_005 505 CDS 100% 10.800 8.640 N Phf20l1 n/a
3 TRCN0000135276 CCTGCCAAGATTGAAGCAATT pLKO.1 673 CDS 100% 10.800 7.560 N PHF20L1 n/a
4 TRCN0000226145 TTGGACAGACTGTCGCTATTA pLKO_005 651 CDS 100% 13.200 7.920 N Phf20l1 n/a
5 TRCN0000230402 TTGGACAGACTGTCGCTATTA pLKO_005 651 CDS 100% 13.200 7.920 N PHF20L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03206 pDONR223 100% 91.5% 90.8% None (many diffs) n/a
2 ccsbBroad304_03206 pLX_304 0% 91.5% 90.8% V5 (many diffs) n/a
3 TRCN0000467004 ACATATTCCTGAGATAGCATTCCT pLX_317 27.7% 91.5% 90.8% V5 (many diffs) n/a
Download CSV