Transcript: Mouse XM_006521076.3

PREDICTED: Mus musculus TATA-box binding protein associated factor 2 (Taf2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Taf2 (319944)
Length:
4769
CDS:
255..3881

Additional Resources:

NCBI RefSeq record:
XM_006521076.3
NBCI Gene record:
Taf2 (319944)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237990 GTCTTGAATCCTACCATTATT pLKO_005 3264 CDS 100% 15.000 21.000 N Taf2 n/a
2 TRCN0000237993 GCCGTCGTTGATTACACTAAA pLKO_005 2931 CDS 100% 13.200 18.480 N Taf2 n/a
3 TRCN0000237989 ATTTGTGGAGCTGACTATATT pLKO_005 395 CDS 100% 15.000 10.500 N Taf2 n/a
4 TRCN0000237992 ATTTGGTGGAGACCGTGTATA pLKO_005 910 CDS 100% 13.200 9.240 N Taf2 n/a
5 TRCN0000237991 GTAGTACATTTGGTGATTATG pLKO_005 4150 3UTR 100% 13.200 9.240 N Taf2 n/a
6 TRCN0000160007 CAAGAAGAAGAAGAAGAAGTA pLKO.1 3713 CDS 100% 4.950 2.475 Y FAM98C n/a
7 TRCN0000177253 GAAGAAGAAGAAGCACAAGAA pLKO.1 3719 CDS 100% 4.950 2.475 Y Zcchc17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.