Transcript: Mouse XM_006521078.3

PREDICTED: Mus musculus tubulin tyrosine ligase-like 1 (Ttll1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttll1 (319953)
Length:
2230
CDS:
546..1817

Additional Resources:

NCBI RefSeq record:
XM_006521078.3
NBCI Gene record:
Ttll1 (319953)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377008 CTTAAGTACAACCTGATTAAC pLKO_005 1572 CDS 100% 13.200 18.480 N Ttll1 n/a
2 TRCN0000098693 GTACGTGATCTCAGTCTATAT pLKO.1 1076 CDS 100% 13.200 18.480 N Ttll1 n/a
3 TRCN0000367653 GTACGTGATCTCAGTCTATAT pLKO_005 1076 CDS 100% 13.200 18.480 N Ttll1 n/a
4 TRCN0000377007 ACAACAGCTTCGGTATGTGAT pLKO_005 2061 3UTR 100% 4.950 6.930 N Ttll1 n/a
5 TRCN0000377009 GTCCCTGCTAAACACCCGTTT pLKO_005 1872 3UTR 100% 4.050 3.240 N Ttll1 n/a
6 TRCN0000098691 CCAGTGATGAACAACGACAAA pLKO.1 1437 CDS 100% 4.950 3.465 N Ttll1 n/a
7 TRCN0000351873 CCAGTGATGAACAACGACAAA pLKO_005 1437 CDS 100% 4.950 3.465 N Ttll1 n/a
8 TRCN0000098690 GCCTTGTAAATAAAGACTCAA pLKO.1 1929 3UTR 100% 4.950 3.465 N Ttll1 n/a
9 TRCN0000098692 GCGTACGTGATCTCAGTCTAT pLKO.1 1074 CDS 100% 4.950 3.465 N Ttll1 n/a
10 TRCN0000098694 GCAAACCATTCGCAACGTGTT pLKO.1 668 CDS 100% 4.050 2.835 N Ttll1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2006 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02860 pDONR223 100% 86.7% 96.9% None (many diffs) n/a
2 ccsbBroad304_02860 pLX_304 0% 86.7% 96.9% V5 (many diffs) n/a
3 TRCN0000472148 TGATGTTCGCCCGTATGGCTTGCC pLX_317 36.6% 86.7% 96.9% V5 (many diffs) n/a
Download CSV