Construct: ORF TRCN0000472148
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013489.1_s317c1
- Derived from:
- ccsbBroadEn_02860
- DNA Barcode:
- TGATGTTCGCCCGTATGGCTTGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TTLL1 (25809)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472148
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 25809 | TTLL1 | tubulin tyrosine ligase like 1 | NM_012263.5 | 100% | 100% | |
| 2 | human | 25809 | TTLL1 | tubulin tyrosine ligase like 1 | XM_017028751.1 | 100% | 100% | |
| 3 | human | 25809 | TTLL1 | tubulin tyrosine ligase like 1 | XM_017028752.1 | 100% | 100% | |
| 4 | human | 25809 | TTLL1 | tubulin tyrosine ligase like 1 | XM_011530108.2 | 91% | 91% | 0_1ins114 |
| 5 | human | 25809 | TTLL1 | tubulin tyrosine ligase like 1 | XM_017028753.2 | 91% | 91% | 0_1ins114 |
| 6 | human | 25809 | TTLL1 | tubulin tyrosine ligase like 1 | XM_006724225.4 | 76.5% | 75.1% | 0_1ins295;28_31delGTTT |
| 7 | human | 25809 | TTLL1 | tubulin tyrosine ligase like 1 | XM_011530110.2 | 73% | 73% | 0_1ins342 |
| 8 | human | 25809 | TTLL1 | tubulin tyrosine ligase like 1 | NR_027779.1 | 67.6% | (many diffs) | |
| 9 | mouse | 319953 | Ttll1 | tubulin tyrosine ligase-like 1 | NM_178869.4 | 86.7% | 96.9% | (many diffs) |
| 10 | mouse | 319953 | Ttll1 | tubulin tyrosine ligase-like 1 | XM_006521078.3 | 86.7% | 96.9% | (many diffs) |
| 11 | mouse | 319953 | Ttll1 | tubulin tyrosine ligase-like 1 | XM_011245659.2 | 86.7% | 96.9% | (many diffs) |
| 12 | mouse | 319953 | Ttll1 | tubulin tyrosine ligase-like 1 | XM_006521079.1 | 66% | 72.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1335
- ORF length:
- 1269
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agggaaagta aaatgggtca ctgatatcga gaagtcagtg ctgatcaata 121 actttgaaaa gagaggatgg gtccaagtga cagaaaacga ggactggaat ttttactgga 181 tgagtgtgca aaccatccga aatgtgttca gcgttgaagc tggatatcgg ctctcagatg 241 accaaatagt caaccatttt ccaaaccact atgaactgac ccggaaggac ctgatggtga 301 agaacatcaa aagatacagg aaggagctgg agaaagaagg gagtcctctg gcagaaaaag 361 atgaaaatgg aaaatacctc tatctggact ttgttccagt cacctatatg ctgcccgctg 421 actacaacct gtttgtagag gagttccgga agagcccgtc cagcacctgg atcatgaagc 481 cttgtggcaa ggcccaggga aagggcatct tccttatcaa caagctctca cagatcaaaa 541 agtggtcccg ggacagcaag acatcttcgt ttgtgtctca atctaataag gaagcctacg 601 tgatctctct ctatattaac aacccgttac taattggcgg gaggaagttc gacctgcgct 661 tgtacgttct ggtgtccacg taccgtccac tgcgctgtta catgtacaag cttgggtttt 721 gccggttctg cacagtgaaa tacaccccga gtaccagtga gctggacaac atgttcgttc 781 atctcaccaa cgtcgccatc cagaaacacg gggaggacta caaccacatc catgggggca 841 agtggacagt gagtaacctg cggctctacc tggAGAGCAC CCGCGGCAAG GAGGTGACCA 901 GCAAGCTGTT CGACGAGATC CACTGGATCA TCGTGCAGTC CCTGAAGGCT GTGGCGCCGG 961 TGATGAACAA TGACAAGCAC TGCTTTGAAT GCTATGGCTA CGACATCATC ATCGACGACA 1021 AGCTGAAGCC CTGGCTGATC GAGGTGAATG CGTCCCCGTC TCTCACGTCC AGCACTGCCA 1081 ATGACCGAAT CCTCAAGTAC AACCTGATTA ATGACACCCT CAACATCGCC GTCCCGAATG 1141 GTGAAATCCC AGACTGCAAA TGGAACAAGT CGCCACCTAA GGAAGTCCTC GGCAATTACG 1201 AGATTCTGTA TGATGAAGAA TTGGCCCAGG GTGACGGGGC TGACCGGGAG CTGAGAAGCC 1261 GTCAGGGTCA GTCTCTGGGG CCCAGAGCAG GCCGATCGAG AGACTCGGGG AGAGCGGTCC 1321 TCACCACCTG GAAGTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1381 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1441 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TGATGTTCGC CCGTATGGCT 1501 TGCCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt