Transcript: Mouse XM_006521253.3

PREDICTED: Mus musculus ADP-ribosylation factor GTPase activating protein 3 (Arfgap3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arfgap3 (66251)
Length:
2719
CDS:
196..1773

Additional Resources:

NCBI RefSeq record:
XM_006521253.3
NBCI Gene record:
Arfgap3 (66251)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521253.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100775 CCCACACAACACACACTTAAA pLKO.1 2193 3UTR 100% 13.200 9.240 N Arfgap3 n/a
2 TRCN0000100779 CCAAAGGAGGAGTCTATTGTT pLKO.1 994 CDS 100% 5.625 3.938 N Arfgap3 n/a
3 TRCN0000100776 GCCGATTCCTACTGGAAGAAA pLKO.1 1345 CDS 100% 5.625 3.938 N Arfgap3 n/a
4 TRCN0000047333 GCCCACTAACAAGGTGTGTTT pLKO.1 252 CDS 100% 4.950 3.465 N ARFGAP3 n/a
5 TRCN0000100778 TGCCGATTCCTACTGGAAGAA pLKO.1 1344 CDS 100% 4.950 3.465 N Arfgap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521253.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.