Transcript: Mouse XM_006521318.2

PREDICTED: Mus musculus collagen triple helix repeat containing 1 (Cthrc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cthrc1 (68588)
Length:
1025
CDS:
154..669

Additional Resources:

NCBI RefSeq record:
XM_006521318.2
NBCI Gene record:
Cthrc1 (68588)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090646 GCTACAGTTGTCCGCACCGAT pLKO.1 222 CDS 100% 0.880 1.232 N Cthrc1 n/a
2 TRCN0000090647 TCATTGAAGAACTACCGAAAT pLKO.1 647 CDS 100% 10.800 8.640 N Cthrc1 n/a
3 TRCN0000090644 GCCCTGAGTTAAATTCAACTA pLKO.1 482 CDS 100% 4.950 3.960 N Cthrc1 n/a
4 TRCN0000090643 GCCCTTGAATGGTTCATTTAA pLKO.1 716 3UTR 100% 15.000 10.500 N Cthrc1 n/a
5 TRCN0000090645 GCTGAATGTTCAGGACCTCTT pLKO.1 427 CDS 100% 4.050 2.835 N Cthrc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04689 pDONR223 100% 60.4% 63.6% None (many diffs) n/a
2 ccsbBroad304_04689 pLX_304 0% 60.4% 63.6% V5 (many diffs) n/a
Download CSV