Transcript: Mouse XM_006521366.3

PREDICTED: Mus musculus TatD DNase domain containing 1 (Tatdn1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tatdn1 (69694)
Length:
1302
CDS:
57..914

Additional Resources:

NCBI RefSeq record:
XM_006521366.3
NBCI Gene record:
Tatdn1 (69694)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176708 CTGTCAGAACAAACACAATTA pLKO.1 468 CDS 100% 13.200 9.240 N Tatdn1 n/a
2 TRCN0000422240 TGTTTCTTCATTGTCGCAATT pLKO_005 493 CDS 100% 10.800 7.560 N Tatdn1 n/a
3 TRCN0000177684 CAACCTGACAGATCCTATGTT pLKO.1 89 CDS 100% 5.625 3.938 N Tatdn1 n/a
4 TRCN0000178714 CATCAACCTGACAGATCCTAT pLKO.1 86 CDS 100% 4.950 3.465 N Tatdn1 n/a
5 TRCN0000177103 CATCAAGATGACTTACAAGAT pLKO.1 138 CDS 100% 4.950 3.465 N Tatdn1 n/a
6 TRCN0000435932 AGCTATCCAGATTGGTGTTAA pLKO_005 170 CDS 100% 13.200 7.920 N Tatdn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09136 pDONR223 100% 81.2% 81.1% None (many diffs) n/a
2 ccsbBroad304_09136 pLX_304 0% 81.2% 81.1% V5 (many diffs) n/a
3 TRCN0000480484 AAATAACTTCCTAAAATAAATTGC pLX_317 49.6% 81.2% 81.1% V5 (many diffs) n/a
Download CSV