Transcript: Mouse XM_006521442.2

PREDICTED: Mus musculus RIKEN cDNA 1810041L15 gene (1810041L15Rik), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
1810041L15Rik (72301)
Length:
5921
CDS:
133..732

Additional Resources:

NCBI RefSeq record:
XM_006521442.2
NBCI Gene record:
1810041L15Rik (72301)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346168 CCGCCATGAACTACGATATTT pLKO_005 494 CDS 100% 15.000 21.000 N 1810041L15Rik n/a
2 TRCN0000346169 GCCTATCCGTGTCGGAATATT pLKO_005 1144 3UTR 100% 15.000 21.000 N 1810041L15Rik n/a
3 TRCN0000346170 GTCCTGGATCTGCTCTATTAT pLKO_005 472 CDS 100% 15.000 10.500 N 1810041L15Rik n/a
4 TRCN0000346171 ATAACAACACTGTCTTCAAAT pLKO_005 317 CDS 100% 13.200 9.240 N 1810041L15Rik n/a
5 TRCN0000376237 GCTTCTGGGAGTGTGGATTTA pLKO_005 426 CDS 100% 13.200 9.240 N 1810041L15Rik n/a
6 TRCN0000376238 ATGACCTTCCAGAGCTCATCC pLKO_005 706 CDS 100% 4.050 2.430 N 1810041L15Rik n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4088 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09256 pDONR223 100% 86.8% 93.5% None (many diffs) n/a
2 ccsbBroad304_09256 pLX_304 0% 86.8% 93.5% V5 (many diffs) n/a
3 TRCN0000480661 GACCCTTAATATATATCCAAGGTG pLX_317 69.3% 86.8% 93.5% V5 (many diffs) n/a
Download CSV